Pratyusha Reddy has asked for the wisdom of the Perl Monks concerning the following question:

This node falls below the community's minimum standard of quality and will not be displayed.

Replies are listed 'Best First'.
Re: Need a code
by Corion (Patriarch) on Jan 24, 2012 at 07:20 UTC
    No. This is not a code writing service. We try to help you on our own time. I consider setting time frames such as "as soon as possible" as very rude. I'm sure your employer or professor expects you to do the work they hired you for yourself. If you have written a program, we will try to help you with your problems there. Also note that this site is named "Perlmonks", not "Biologymonks" or "Geneticmonks", so you will make things much easier for us if you translate the technical terms of your field into the technical terms of Perl.
      Since the removal of the OP to which Corion directed the reply aboves leave the reply without context, what follows is apparently the original SOPW (p tags closed, even tho not required by w3c) to follow PM guidance:

      Hello,

      I am a beginner in perl and need a program to identify the sequence present in between 2 given co-ordinates.

      For example consider a sequence "ACGTGACGACCAGATTACCACGCTATCGACG" (i.e the data we have about a whole genome of an organism) we have to input the seq using STDIN, later should ask for the co-ordinates (here consider we enter 5 - 8, the output should be GACG) and should also print how many times it is repeated in entire genome and should also tell whether the sequence is a gene or any regulatory element.

      so please provide me the code as early as possible.

Re: Need a code
by marto (Cardinal) on Jan 24, 2012 at 09:53 UTC

    "so please provide me the code as early as possible."

    That's really not what we do here. Saying you're new to perl is good, showing no effort, a specification for the software you're supposed to deliver then asking for the whole thing to be done for you isn't so good.

    Since you're new to perl and this site I suggest you take the time to read and understand the following:

    If you have any questions about perl and programming, rather than just requests for people to do your work, let us know.

Re: Need a code
by Anonymous Monk on Jan 24, 2012 at 07:39 UTC
    I fear you are confusing perlmonks with the Amazon Mechanical Turk (just google for it or use the following link):
    http://en.wikipedia.org/wiki/Amazon_Mechanical_Turk
Re: Need a code
by AnomalousMonk (Archbishop) on Jan 24, 2012 at 13:45 UTC
    ... please provide me the code as early as possible.

    I enthusiastically second the comments of others concerning this request and the OP in general!

    ... ask for the co-ordinates ... enter 5 - 8, the output should be GACG ...

    Just a side note: The example given implies the use of base-1 indexing. It might be better to use the more common (certainly more common to Perl!) base-0 indexing, or else prominently to announce the use of, and the desire to continue to use, base-1 indexing.

Re: Need a code
by Old_Gray_Bear (Bishop) on Jan 24, 2012 at 17:51 UTC
    A couple of questions and a comment:
    • How large is your data set?
    • How do I "tell whether the sequence is a gene or any regulatory element"?
    • My billing rate is $75 (US) per hour with an eight hour minimum, payable in advance. If you are still interested, send me a private message.
    Perl Monks is not a code-generation service. All of us have day-jobs (for some of us that job is 'full time student'). Mine happens to be 'Perl Consultant'. If you want me to spend time on your project, you will need to pay me for it.

    ----
    I Go Back to Sleep, Now.

    OGB

Re: Need a code
by Xiong (Hermit) on Jan 25, 2012 at 03:10 UTC

    I have to disagree, with respect to my fellow Monks. I enjoy solving other people's problems and, since I'm stalled on my own work, I'm delighted to write your code for you. Besides, your problem looks like fun.

    My fellow Monks dislike your post. I don't much like it either -- the tone is way off -- but I'm willing to make allowances. You may sound as if you expect others to be eager to serve you; I don't penalize you for your cultural background.

    Still, I will not write your code. Your specification stinks but that's usual and your needs are trivial... right up to the phrase tell whether the sequence is a gene or any regulatory element. This tells me you are one of those damn "biotech" guys who couldn't care less about silicon. You are not one of us who has been oppressed into working for some of them. It's obvious that the problem domain is genetic; but your abrupt slide from parsing a string into a totally unrelated requirement involving an unmentioned database tells me you are not a programmer. And you probably make a fuss every time one of us opens his car door into yours in the parking lot.

    So, you're on your own. Maybe you can genetically engineer a recursive monkey to type it up for you.

    I'm not the guy you kill, I'm the guy you buy. —Michael Clayton