Since the removal of the OP to which Corion directed the reply aboves leave the reply without context, what follows is apparently the original SOPW (p tags closed, even tho not required by w3c) to follow PM guidance:

Hello,

I am a beginner in perl and need a program to identify the sequence present in between 2 given co-ordinates.

For example consider a sequence "ACGTGACGACCAGATTACCACGCTATCGACG" (i.e the data we have about a whole genome of an organism) we have to input the seq using STDIN, later should ask for the co-ordinates (here consider we enter 5 - 8, the output should be GACG) and should also print how many times it is repeated in entire genome and should also tell whether the sequence is a gene or any regulatory element.

so please provide me the code as early as possible.