Re: Need a code

No. This is not a code writing service. We try to help you on our own time. I consider setting time frames such as "as soon as possible" as very rude. I'm sure your employer or professor expects you to do the work they hired you for yourself. If you have written a program, we will try to help you with your problems there. Also note that this site is named "Perlmonks", not "Biologymonks" or "Geneticmonks", so you will make things much easier for us if you translate the technical terms of your field into the technical terms of Perl.

Comment on Re: Need a code

Replies are listed 'Best First'.
Re^2: Need a code by ww (Archbishop) on Jan 28, 2012 at 13:07 UTC
Since the removal of the OP to which Corion directed the reply aboves leave the reply without context, what follows is apparently the original SOPW (p tags closed, even tho not required by w3c) to follow PM guidance: Hello, I am a beginner in perl and need a program to identify the sequence present in between 2 given co-ordinates. For example consider a sequence "ACGTGACGACCAGATTACCACGCTATCGACG" (i.e the data we have about a whole genome of an organism) we have to input the seq using STDIN, later should ask for the co-ordinates (here consider we enter 5 - 8, the output should be GACG) and should also print how many times it is repeated in entire genome and should also tell whether the sequence is a gene or any regulatory element. so please provide me the code as early as possible.	[reply]

Replies are listed 'Best First'.

Re^2: Need a code
by ww (Archbishop) on Jan 28, 2012 at 13:07 UTC

Corion

PM guidance

Hello,

I am a beginner in perl and need a program to identify the sequence present in between 2 given co-ordinates.

For example consider a sequence "ACGTGACGACCAGATTACCACGCTATCGACG" (i.e the data we have about a whole genome of an organism) we have to input the seq using STDIN, later should ask for the co-ordinates (here consider we enter 5 - 8, the output should be GACG) and should also print how many times it is repeated in entire genome and should also tell whether the sequence is a gene or any regulatory element.

so please provide me the code as early as possible.

[reply]